Blog

Méthodes microbiologiques diagnostiques dans l’étude de cas / contrôle GEMS

Pour comprendre l’étiologie de la diarrhée modérée à sévère chez les enfants dans les zones à forte mortalité en Afrique subsaharienne et en Asie du Sud, nous avons réalisé une étude de cas / contrôle complète des enfants âgés de & lt; années sur les sites Chaque site utilisait une étude de cas / contrôle identique et chacun utilisait un ensemble complet et uniforme de tests microbiologiques pour identifier les étiologies bactériennes, virales et protozoaires probables. Les essais sélectionnés ont effectué un examen équilibré du coût, de la robustesse et de la performance. Les bactéries diarrhéiques Escherichia coli ont été identifiées par l’application d’un test de réaction en chaîne de la polymérase multiplex pour le colavirus entérotoxinogène, entéroaggregatif et entéropathogène E. coli, adénovirus, Entamoeba histolytica, Giardia enterica et des espèces de Cryptosporidium ont été détectées par des immunodosages enzymatiques disponibles dans le commerce sur des échantillons de selles. Des échantillons positifs pour des adénovirus ont été évalués pour des sérotypes adénoviraux. Nous avons développé un nouveau test multiplex pour détecter les types de norovirus et les astrovirus. rus Le portefeuille de tests diagnostiques utilisé dans l’étude GEMS peut être largement appliqué dans les pays en développement à la recherche de méthodes robustes et rentables pour la détection des pathogènes entériques

Les maladies diarrhéiques restent parmi les principales causes mondiales de décès chez les enfants. Un manque important d’études sur les maladies diarrhéiques menées avant l’étude mondiale sur les maladies entériques a été l’absence d’une évaluation complète des principaux agents pathogènes entériques, en particulier dans les sites où la charge diarrhéique est la plus élevée. La mortalité diarrhéique est généralement celle qui pose le plus de difficultés pour réaliser le portefeuille techniquement exigeant de dosages et de protocoles requis pour identifier les agents pathogènes bactériens, viraux et protozoaires. Le but du GEMS est donc d’assurer une identification précise et cohérente des pathogènes pertinents dans tous les GEMS. sites d’étude Afin d’accomplir la tâche difficile mais importante d’identifier de manière cohérente les agents pathogènes clés sur tous les sites GEMS, dans les limites internes et externes significatives, nous avons établi les exigences suivantes pour un ensemble complet de tests de diagnostic: Performance: avoir satisfait sensibilité et spécificité Bien que difficile à définir, nous aspirions à atteindre des performances équivalentes aux standards nécessaires pour une gestion clinique efficace dans la plupart des contextes, et satisfaisantes pour assurer une détermination suffisamment précise de la charge et la génération de données fiables. les structures d’AQ assurance, les méthodes nécessaires pour être cohérentes dans tous les sites, nécessitant une formation et une supervision réalisables, ainsi que la possibilité de vérification et de validation à l’aide d’études post-hoc. Efficacité-GEMS: budget généreux mais limité. La perspective Delphic: Nous avons recruté des experts respectés sur chaque pathogène pour assurer un soutien expert dans la sélection des méthodes, la formation du personnel et les programmes d’assurance qualité. Nous décrivons les méthodes et protocoles de laboratoire de microbiologie clinique utilisés dans l’étude GEMS. Les essais ont été adaptés à partir de méthodes publiées qui avaient été développées, validées et soumises à un examen par des pairs de manière indépendante

Collecte et traitement des échantillons de selles

Les échantillons fécaux de l’étude GEMS ont été livrés au laboratoire dans des récipients froids. Voir Kotloff et al dans ce supplément. Au point de collecte ou lors de l’entrée au laboratoire, une aliquote fécale a été introduite dans des tubes contenant du milieu Cary-Blair. et une solution saline tamponnée au glycerol BGS Lorsque aucun spécimen de selles n’était disponible, un prélèvement rectal a été obtenu; ces prélèvements rectaux ont été immédiatement insérés dans des tubes contenant des milieux Cary-Blair et BGS. Au moment de l’arrivée au laboratoire, le personnel du laboratoire a inspecté l’échantillon pour la température et le volume des selles d’au moins mL; un délai d’attente entre la collecte des selles et l’inoculation des milieux de transport ne devait pas dépasser les heures et le temps entre le transport du spécimen dans le milieu de transport et l’adhésion n’était pas supérieur à des heures. tests comme décrit ci-dessous

Microbiologie fécale conventionnelle

Le protocole GEMS comprenait une culture bactérienne conventionnelle, principalement pour que la croissance pure des pathogènes impliqués puisse être validée indépendamment par les laboratoires centraux et caractérisée davantage par la virulence, la sérologie et les propriétés de résistance antimicrobienne cymbalta 30 mg. Les bactéries sélectionnées pour l’isolement et l’identification comprenaient des bactéries Gram négatif de La liste finale des agents recherchés a été examinée par les investigateurs et le comité directeur de la microbiologie du GEMS. Les agents pathogènes recherchés comprenaient l’entérotoxinogène diarrhéique [ECET], l’entéropathogène [EPEC] et l’entéroagrégatif. [EAEC] Escherichia coli, sérovars de Salmonella enterica, Shigella spp, Campylobacter spp, Vibrio spp et Aeromonas spp L’algorithme de caractérisation bactériologique comprend un milieu différentiel, un milieu modérément sélectif, un milieu hautement sélectif et au moins un enrichissement. bouillon Tous les protocoles ont été adaptés à partir du Manuel de Microbiologie Clinique, Huitième Edition Du tube de Cary-Blair, des écouvillons ont été étalés sur MacConkey MAC, xylose lysine désoxycholate XLD, thiosulfate citrate sels biliaires sucrose TCBS, Aeromonas Ryan , Campy-BAP , et les milieux aqueux de peptone alcaline; à partir du BGS, l’écouvillon a été étalé sur des milieux MAC et XLD Des plaques ont été incubées à ° C à l’exception des milieux Campylobacter spp ° C et Aeromonas spp ° C- ° C Après incubation, des colonies suspectes ont été sélectionnées et soumises à une série de des tests biochimiques qui pourraient être effectués commodément dans des milieux pauvres en ressources, en minimisant les dépenses, la difficulté d’approvisionnement en réactifs et le besoin d’une formation ou d’un équipement sophistiqué. Les tests de confirmation utilisés sont décrits ci-dessous.

Enterobacteriaceae

Les colonies ont été inoculées dans du fer triple sucres, de la motilité indole ornithine MIO et des milieux lysine décarboxylase, ainsi que des milieux de typage biochimiques citrate et urée, et incubées à ° C ° C pendant la nuit. Isolats biochimiquement suspects pour Salmonella enterica [urée oxydase] ont été sérotypés avec O et Vi polyvalents selon les instructions du fabricant Denka Seiken Tous les isolats identifiés biochimiquement comme Shigella spp ont été sérotypés avec les groupes polyvalents A, B, C et D en utilisant les protocoles du fabricant Denka Seiken ou Reagensia

Vibrio spp Isolement et identification

Les plaques d’agar TCBS ont été examinées pour la croissance le jour; de grandes colonies jaunes et vertes ont été repiquées à la TSA agar de soja Trypticase et incubées à ° C pendant la nuit. Aucune culture de colonies ressemblant à Vibrio spp après une nuit d’incubation sur les plaques de TCBS, la sous-culture de TSA a été testée pour la production d’oxydase; Si l’oxydase est positive, les isolats ont été testés pour la tolérance au sel avec différentes concentrations de NaCl additionnées de bouillon nutritif%,% et% Si la colonie était jaune sur TCBS et qu’il y avait croissance en% et pas de croissance au bouillon nutritif% NaCl, puis les isolats de Vibrio putatifs ont été réincubés à ° C pendant encore 1 heure; en même temps, l’eau peptonée alcaline a été repiquée dans une nouvelle plaque TCBS et incubée à ° C. Chaque jour, chaque Vibrio cholerae a été confirmé sérologiquement en utilisant des antisérums O et O Denka Seiken et V cholerae O-positives ont été typés en sérotypes Inaba ou Ogawa. Si la colonie était verte sur TCBS et qu’il y avait une croissance des concentrations de NaCl de% et de%, et aucune croissance en%, ceci a été considéré présomptif pour Vibrio parahaemolyticus

Aeromonas spp Isolement et identification

Le jour, les plaques de gélose Ryan ont été examinées pour des colonies vert foncé avec des centres verts plus foncés. Ces colonies ont été repiquées sur des plaques de TSA, testées pour la tolérance au sel avec différentes concentrations de NaCl%,% et%. Des tests de catalase à partir de la plaque TSA ont été effectués et des tubes ont été lus pour différentes concentrations de NaCl. La sensibilité à l’O /, -diamino-, -diisopropyl ptéridine a également été évaluée . ou%, et était résistant à O /, a été considéré comme appartenant à l’espèce Aeromonas

Campylobacter spp Isolation et identification

Le jour, la plaque de gélose au sang de Campy a été observée pour la croissance apparaissant de l’une des manières suivantes: teinte non hémolytique, grise, jaunâtre ou rosée; colonies plates, étalées, à bords irréguliers; mucoïde; couche mince; se répandre le long de la marque de strie; ou rondes et convexes Des essais d’oxydase et de catalase ont été effectués et un tube d’hippurate de sodium a été inoculé. Si des isolats étaient oxydase et catalase, des frottis ont été préparés pour la coloration de Gram. Le frottis a été examiné au microscope optique. Forme S « L’essai d’hydrolyse de l’hippurate de sodium a ensuite été effectué pour confirmation. Les isolats positifs à l’hydrolyse de l’hippurate ont été classés comme Campylobacter jejuni; si l’hydrolyse de l’hippurate était négative, les souches ont été classées comme Campylobacter coli

Isolement et identification de E. coli

Croissance de jour sur des plaques MAC, plusieurs colonies bactériennes fermentant le lactose ressemblant à E. coli ont été prélevées et testées en utilisant un milieu MIO. Jusqu’à des colonies positives au lactose et indole positives ont été sélectionnées Quand il y avait plusieurs morphologies distinctes de colonies E coli-like sélectionné S’il y a eu & lt; colonies colonies d’organismes apparentés à E. coli fermentant le lactose, puis toutes les colonies positives au lactose ont été prélevées, et ≥ colonies lactose-négatives ont été prélevées pour atteindre le total des colonies par échantillon. Les colonies positives à l’indole ont été conservées pour analyse ultérieure. , une seconde série de tests biochimiques, Indole / Méthyle Rouge / Voges Proskauer / Citrate a été utilisée pour identifier E. coli Si l’un était positif pour le rouge de méthyle et négatif pour Voges Proskauer et le citrate, ils ont été conservés pour une analyse ultérieure. non trouvé, c.-à-d. positif pour l’indole ou une autre réaction biochimique suggestive, le microbiologiste est retourné à la plaque d’origine et ramassé à d’autres colonies pour des tests biochimiques. Les pathotypes ECTEC, EPEC et EAEC ont été identifiés par PCR PCR. adapté aux fins de GEMS Les cibles recherchées via la réaction PCR comprenaient l’entérotoxine ETEC thermolabile et l’entérotoxine thermostable dérivée de S Les gènes Th, l’EPEC intimin eae gène la membrane externe de la protéine adhésine; le pilus BFP formant un faisceau codé par un plasmide EPEC; le gène codé par le plasmide EAEC aatA; et le locus aaiC codé par chromosome d’EAEC Tous ces locus sont des déterminants de virulence connus de leurs agents pathogènes respectifs. Des souches positives pour eae mais pas BFP ont été désignées souches EPEC atypiques positives pour l’entérotoxine ETEC ont été considérées ETEC et les souches positives pour le facteur EAEC ont été Les colonies de type E coli sélectionnées dans chaque selle ont été regroupées dans un tube d’échantillon commun et l’ADN modèle a été préparé à partir des colonies regroupées. L’ADN modèle a été préparé en faisant bouillir les cultures sur L-agar pendant des minutes, refroidissement rapide sur de la glace, suivi d’une brève centrifugation à g pendant quelques minutes. Ce surnageant a été utilisé dans les tests de PCR. Les séquences nucléotidiques d’amorces et les longueurs prédites des amplicons résultants sont listées dans le tableau.

Séquences de l’amorce de tableau et tailles d’amplicon attendues pour la réaction en chaîne de la polymérase multiplexe utilisée dans la détection de la séquence d’amorces du gène cible de l’amorce pathogène d’Escherichia coli diarrhéique ‘-‘ Amplicon bp ETEC LT-F CACACGGAGCTCCCCAGTC LT-R CCCCCAGCCTAGCTTAGTTT ST-F est GCTAAACCAGTAG / AGGTCTTCAAAA ST-R CCCGGTACAG / AGCAGGATTACAACA EPEC BFPA-F BFPA GGAAGTCAAATTCATGGGGG BFPA-R GGAATCAGACGCAGACTGGT EAE-F eae CCCGAATTCGGCACAAGCATAAGC EAE-R CCCGGATCCGTCTCGCCAGTATTCG EAEC CVDF AATA CTGGCGAAAGACTGTATCAT CVDR CAATGTATAGAAATCCGCTGTT CIAC F CIAC ATTGTCCTCAGGCATTTCAC CIAC R ACGACACCCCTGATAAACAA Pathogen Primer Target Gene Primer Sequence ‘-‘ amplicon pb ETEC LT-Facteur CACACGGAGCTCCTCAGTC LT-R CCCCCAGCCTAGCTTAGTTT ST-F est GCTAAACCAGTAG / AGGTCTTCAAAA ST-R CCCGGTACAG / AGCAGGATTACAACA EPEC BFPA-F bfpA GGAAGTCAAATTCATGGGGG BFPA-R GGAATCAGACGCAGAC TGGT EAE-F eae CCCGAATTCGGCACAAGCATAAGC EAE-R CCCGGATCCGTCTCGCCAGTATTCG EAEC CVDF aatA CTGGCGAAAGACTGTATCAT CVDR CAATGTATAGAAATCCGCTGTT AAIC FaiçaC ATTGTCCTCAGGCATTTCAC AAIC R ACGACACCCCTGATAAACAA Abréviations: EAEC, Escherichia coli entéro-agrégative; EPEC, E coli entéropathogène; ETEC, E coliView entérotoxigène LargePour la réaction de PCR, on ajoute μL d’ADN matrice au mélange PCR contenant μL de tampon PCR × avec MgCl MgCl New England Biolabs, μL de mM désoxynucléotide triphosphates dNTPs Fermentas, μL de pmol / μL de chaque amorce, μL Taq ADN polymérase U / μL, New England Biolabs et μL d’eau exempte de RNase jusqu’à un volume final de μL PCR a été réalisée dans les conditions suivantes: préchauffage à ° C pendant quelques minutes, dénaturation à ° C pendant quelques secondes, recuit à ° C pendant quelques secondes, un allongement à ° C pour une PCR minute a été réalisé pour des cycles avec une extension finale à ° C pendant quelques minutes dans un cycleur thermique Eppendorf Mastercycler Gradient. Le même cycleur thermique modèle a été utilisé sur tous les sites. visualisé par transillumination à la lumière ultraviolette après coloration au bromure d’éthidium L’échelle d’ADN -kb plusA -bp New England Biolabs a été utilisée comme marqueur de taille moléculaire dans le gel. Les amplicons PCR sur électrophorèse sur gel d’agarose sont présentés dans la figure. Les souches témoins utilisées dans chaque réaction de PCR étaient ETEC H, EAEC, et pour les souches EPEC CVD eae-positives et HBpMAR bfpA-positives

Figure Vue largeDownload slideAppearance des amplicons diarrhéiques d’Escherichia coli séparés par électrophorèse sur gel d’agarose Lane, E coli entéropathogène; voie, E coli entéroagrégatif; , E coli entérotoxigène; voies et, souches de contrôle négatif; voie, échelle d’ADN de bp New England BiolabsFigure View largeDownload slideAppearance des amplicons diarrhéiques d’Escherichia coli séparés par électrophorèse sur gel d’agarose Voie, E coli entéropathogène; voie, E coli entéroagrégatif; , E coli entérotoxigène; voies et, souches de contrôle négatif; voie, échelle d’ADN bp New England Biolabs

Caractérisation des souches eae-positives, bfpA-négatives

Dans le cadre d’une étude emboîtée, tous les spécimens d’E. Coli qui étaient négatifs dans la PCR multiplex originale pour elt, est, bfpA, eae, aatA et aaiC ont été étudiés à l’Université de Melbourne, en Australie, à l’aide d’un haut débit. Dosage PCR en temps réel Des échantillons, constitués d’isolats individuels, ont été envoyés à Melbourne depuis Baltimore sur MAC agar dans des plateaux de microtitrage à fond plat. À l’arrivée, les cultures ont été répliquées sur gélose MAC et cultivées pendant une nuit à ° C. ADN pour l’utilisation dans la PCR en temps réel, une pointe de pipette stérile a été utilisée pour transférer une partie d’un échantillon de culture de la plaque de réplique MAC dans un puits unique d’un puits de PCR plateau Bio-Rad contenant de l’eau a été répétée pour les échantillons restants de l’échantillon, de sorte que chaque puits contenait des spécimens comprenant des isolats séparés. La plaque a été scellée avec un adhésif Microseal « A » Bio-Rad Pour lyser les cellules bactériennes, les échantillons ont été chauffés à PCR m Achine Bio-Rad suivie d’un refroidissement à ° C Avant utilisation, la plaque a été centrifugée pendant une minute à g et le surnageant a été utilisé comme ADN matrice dans l’analyse PCR en temps réel. Pour la PCR en temps réel, μL d’un mélange maître a été ajouté. Le mélange maître en temps réel, pour une réaction, comprenait μL de × SSoFast EvaGreen Supermix Bio-Rad, μL d’eau sans DNase et μL de μM de chaque amorce La plaque a été scellée avec de l’adhésif Microseal « B » Bio-Rad et centrifugée pendant quelques secondes. g La PCR en temps réel a été réalisée en utilisant une machine de PCR en temps réel CFX Bio-Rad en utilisant le protocole suivant: ° C Les résultats ont été analysés à l’aide du logiciel CFX Manager. La liaison Bio-Rad du colorant SSoFast EvaGreen aux produits de PCR à double brin colorant à fluorescer Le seuil du cycle est le nombre de cycles auquel la fluorescence dépasse le niveau de fond Figure Dans notre étude, les échantillons avec un seuil de cycle de ≤ ont été analysés en outre Les souches témoins utilisées dans chaque PCR incluaient les souches EPEC E /, E, W et TR qui portent l’intimine alpha, bêta, gamma et epsilon, respectivement contrôles positifs; et ETEC souche H et E coli K- Contrôles négatifs MC Trois contrôles «sans matrice d’ADN» ont également été inclus Chaque isolat individuel dans un échantillon eae-positif a été analysé en utilisant un PCR multiplex pour confirmer la présence de eae, et aussi pour tester pour la présence de marqueurs génétiques d’EPEC bfpA typique, E. coli produisant la toxine Shiga, et / ou E coli entérohémorragique EHEC stx, stx, ehxA Template ADN pour une utilisation dans cette PCR a été préparé en remettant en suspension une anse des échantillons de culture individuels de la Plaque de réplique MAC en μL d’eau exempte de DNase, puis ébullition de la suspension pendant quelques minutes Le lysat bactérien bouilli a été rapidement refroidi sur de la glace pendant quelques minutes puis centrifugé pendant quelques minutes à la température de g. glace ou à ° C jusqu’à utilisation dans le PCR

Figure Vue largeDownload slideUn exemple des résultats graphiques de la réaction en chaîne de la polymérase en temps réel sur des échantillons eae-positifs rouges, inconnus verts et négatifs jaunes et bleus Un seuil de détection de la fluorescence ADN est légèrement supérieur aux niveaux de fluorescence de fond View largeTexte des diapositivesUn exemple de résultats graphiques de la réaction en chaîne de la polymérase en temps réel sur des échantillons eae-positifs rouges, inconnus verts et négatifs jaunes et bleus Un seuil de détection de la fluorescence à base d’ADN est légèrement supérieur aux niveaux de fluorescence de fond PCR Un mélange maître Green GoTaq Promega, qui contenait l’ADN polymérase Taq, dNTPs, MgCl, tampons de réaction, et le colorant de chargement, a été utilisé La PCR a été réalisée dans une machine PCR C Bio-Rad en utilisant le protocole suivant: ° C par cycles de ° C pour les secondes, ° C pour les secondes et ° C pour les secondes, suivi du cycle de ° C pour les minutes. Les produits de fication ont été séparés à l’aide d’un gel d’agarose Tris-acétate-EDTA% et visualisés par transillumination à la lumière ultraviolette. Echelle d’ADN A -bp New England Biolabs a été utilisé comme marqueur de taille moléculaire Des exemples des résultats de cette PCR sont présentés dans Figure chaque réaction de PCR était la souche EPEC E / pour eae et bfpA et la souche EHEC EH pour stx, stx et ehxA Les amorces qui ont été utilisées dans la PCR en temps réel eae sont listées dans le tableau; les conditions de réaction sont énumérées dans le tableau; les séquences nucléotidiques de l’amorce et les longueurs prédites des amplicons résultants sont listées dans le tableau

Séquences de tableau d’amorces et taille d’amplicon attendue pour la séquence d’amorces de réaction en chaîne de la polymérase en temps réel ‘-‘ TargetGene Ampliconbp eae-F CAGGCTTCGTCACAGTTG eae-R CCGTCAAAGTTATTACCACTCTG Séquence d’amorces ‘-‘ TargetGene Ampliconbp eae-F CAGGCTTCGTCACAGTTG eae-R CCGTCAAAGTTATTACCACTCTG Agrandir l’image

Composants du tableau de la réaction en chaîne polymérase multiplexe × réaction en chaîne de la polymérase × mélange maître vert GoTaq μL μM bfpA-F μL μM bfpA-R μL μM ehxA-F μL μM ehxA-R μL μM eae-F μL μM eae-R μL μM stx -F μL μM stx-R μL μM stx-F μL μM stx-R μL Modèle d’ADN μL Volume total μL × réaction en chaîne de la polymérase × GoTaq Green Master Mix μL μM bfpA-F μL μM bfpA-R μL μM ehxA-F μL μM ehxA-R μL μM eae-F μL μM eae-R μL μM stx-F μL μM stx-R μL μM stx-F μL μM stx-R μL Modèle d’ADN μL Volume total μL View Large

Tableau Séquences d’amorces et les tailles amplimère prévue pour l’amorce de réaction en chaîne multiplex Polymerase Séquence ‘-‘ TargetGene Ampliconbp eae-F GACCCGGCACAAGCATAAGC eae eae-R CCACCTGCAGCAACAAGAGG ehxA-F GCATCATCAAGCGTACGTTCC ehxA ehxA-R AATGAGCCAAGCTGGTTAAGCT stx-F ATAAATCGCCATTCGTTGACTAC STX STX-R AGAACGCCCACTGAGATCATC STX F GGCACTGTCTGAAACTGCTCC stx stx-R TCGCCAGTTATCTGACATTCTG BFPA-F GGAAGTCAAATTCATGGGGG BFPA BFPA-R GGAATCAGACGCAGACTGGT Primer Sequence ‘-‘ TargetGene Ampliconbp eae-F GACCCGGCACAAGCATAAGC eae eae-R CCACCTGCAGCAACAAGAGG ehxA-F GCATCATCAAGCGTACGTTCC ehxA ehxA-R AATGAGCCAAGCTGGTTAAGCT stx-F ATAAATCGCCATTCGTTGACTAC stx stx-R AGAACGCCCACTGAGATCATC stx-F GGCACTGTCTGAAACTGCTCC stx-R TCGCCAGTTATCTGACATTCTG bfpA-F GGAAGTCAAATTCATGGGGG bfpA bfpA-R GGAATCAGACGCAGACTGGT Agrandir l’image

Figure Vue largeDownload slideGels montrant les résultats d’une réaction en chaîne par polymérase multiplex PCR pour Escherichia coli entéropathogène, E. coli producteur de toxine Shiga et E. coli entérohémorragique EHEC Les isolats individuels d’échantillons ont été soumis à une PCR multiplex comme décrit dans le texte. , séparés par des lignes verticales jaunes, sont constitués d’isolats individuels Les valeurs jaunes indiquent le seuil de cycle obtenu pour chaque échantillon dans la PCR en temps réel utilisée pour le criblage initial des eae Les amplicons produits par les contrôles positifs, EPEC E / eae et bfpA et EHEC EH stx, stx, et ehxA sont également indiqués bp échelle d’ADN a été utilisé comme marqueur de taille moléculaire Abréviation: NTC, aucun modèle controlFigure View largeDownload slideGels montrant les résultats d’une réaction en chaîne polymérase multiplex PCR test pour Escherichia coli entéropathogène EPEC, toxine Shiga E. coli productrices d’E. Coli EHEC entérohémorragiques isolées à partir de spécimens Les échantillons de chaque échantillon, séparés par des lignes verticales jaunes, sont constitués d’isolats individuels. Les valeurs jaunes indiquent le seuil de cycle obtenu pour chaque échantillon dans la PCR en temps réel utilisée pour le criblage initial des amplicons produits. par les témoins positifs, EPEC E / eae et bfpA et EHEC EH stx, stx, et ehxA sont également indiqués bp échelle d’ADN a été utilisé comme un marqueur de taille moléculaire Abréviation: NTC, pas de contrôle de modèle

Immunoessais viraux

Les immunodosages enzymatiques sont des tests diagnostiques rapides, robustes, sensibles et spécifiques pour certains pathogènes viraux. Nous avons utilisé des immunodosages commerciaux validés pour le rotavirus et l’adénovirus selon des protocoles établis.

Rotavirus

L’antigène VP du rotavirus a été détecté dans les selles par le kit ProSpecT ELISA Rotavirus en suivant les instructions du fabricant Oxoid

Adénovirus

Oxide Ce test utilise un anticorps monoclonal spécifique au genre pour détecter les épitopes communs à tous les sérotypes d’adénovirus humains. Des échantillons pour l’adénovirus par le test ProSpecT ont été testés pour la présence d’adénovirus entériques. sérotypes / en utilisant le kit Premier Adenoclone Meridian Bioscience suivant les instructions du fabricant

PCR multiplex pour la détection de virus à ARN

Les échantillons de selles ont été dilués à% w / v ou v / v suspensions dans Vertrel XF Miller Stephenson et centrifugés à g pendant des minutes Le surnageant a été recueilli et stocké à ° C avant l’extraction de l’ARN ARN viral a été extrait du surnageant des selles. instructions du fabricant En bref, μL de tampon de lyse a été ajouté à μL de surnageant, vortexé et incubé pendant minutes, puis μL de suspension de silice a été ajouté, vortexé et centrifugé à g pendant quelques secondes. Le lavage a été fait en ajoutant deux fois avec un ml de% d’éthanol deux fois. Enfin, on ajoute ml d’acétone au culot. A la fin de chaque étape de lavage, les tubes sont vortexés et centrifugés à température ambiante pendant quelques secondes à la température de g; Le culot de silice a été séché à ° C pendant quelques minutes et le culot a été reconstitué en ajoutant un ul de tampon d’élution. Les échantillons ont été vortexés et incubés à ° C pendant quelques minutes, l’étape d’incubation a été répétée et l’échantillon a été reconstitué. centrifugé pendant quelques minutes à g contenant l’ARN surnageant contenant de l’ARN et stocké à-° C jusqu’à ce que l’ARNr soit transcrit en sens inverse dans un volume total de μL contenant le tampon premier brin Invitrogen, mM dNTPs Roche, mM dithiothréitol Invitrogen, μg d’amorces aléatoires TaKaRa, des unités de l’inhibiteur de la RNase Roche et des unités de la transcriptase inverse RT de la souche II; Invitrogen Le mélange a été incubé à ° C pendant une heure puis chauffé à ° C pendant quelques minutes. Une réaction PCR multiplexe a été conçue pour amplifier le norovirus, l’astrovirus et le sapovirus ADN complémentaire ADNc présent dans les réactions de transcription inverse décrites ci-dessus. Après la synthèse de l’ADNc, PCR multiplex a été réalisée en utilisant des amorces spécifiques Tableau PCR mélange maître contenu μM concentration d’amorces spécifiques, dNTP Roche mM, × AmpliTaq tampon I, et U de AmpliTaq ADN polymérase Applied Biosystems pour un mélange réactionnel -μL Master Mix a été distribué à tubes -ML PCR, et pi d’ADNc matrice a été ajouté L’essai a été confirmée en utilisant l’ADNc de contrôles positifs et négatifs de confirmés réactions antérieures Les réactions de PCR ont été réalisées dans un thermocycleur gradient Eppendorf Mastercycler en commençant par une étape de dénaturation de minutes à ° C, puis par des cycles de secondes à ° C, de secondes à ° C et de secondes à ° C, suivi d’une extension de ° C pour minutes Après l’étape de thermocyclage, tous les produits de PCR ont été soumis à une électrophorèse sur un gel d’agarose en% et dimensionnés avec une échelle -bp Promega Figure

Tableau d’apprêts Sequences et les amplicons Tailles pour la chaîne multiplex Polymerase attendus réaction utilisé dans la détection des virus à ARN Pathogen Primer Primer séquence ‘-‘ amplicon pb Norovirus GI GSKR CCAACCCARCCATTRTACA GSKF CTGCCCGAATTYGTAAATGA Norovirus GII GSKR CCRCCNGCATRHCCRTTRTACAT COGF CARGARBCNATGTTYAGRTGGATGAG Sapovirus SLV CGGRCYTCAAAVSTACCBCCCCA SLV CTCGCCACCTACRAWGCBTGGTT astrovirus b GTGAGCCACCAGCCATCCCT PreCAP GGACTGCAAAGCAGCTTCGTG Cogr TCGACGCCATCTTCATTCACA Pathogen Primaire Primaire séquence ‘-‘ amplicon pb norovirus GI GSKR CCAACCCARCCATTRTACA GSKF CTGCCCGAATTYGTAAATGA norovirus GII GSKR CCRCCNGCATRHCCRTTRTACAT COGF CARGARBCNATGTTYAGRTGGATGAG Sapovirus SLV CGGRCYTCAAAVSTACCBCCCCA SLV CTCGCCACCTACRAWGCBTGGTT astrovirus b GTGAGCCACCAGCCATCCCT PreCAP GGACTGCAAAGCAGCTTCGTG Cogr TCGACGCCATCTTCATTCACA Voir Grande

Figure Vue largeDownload slideAppearance des amplicons viraux entériques séparés par électrophorèse sur gel d’agarose Lane M, bp échelle d’ADN New England Biolabs; voie, Norovirus GI bp; voie, Norovirus GII positif bp; voie, sapovirus bp; voie, astrovirus bpFigure Voir grandDownload slideAppearance des amplicons viraux entériques séparés par électrophorèse sur gel d’agarose Lane M, bp échelle d’ADN New England Biolabs; voie, Norovirus GI bp; voie, Norovirus GII positif bp; voie, sapovirus bp; voie, astrovirus bp

Détection des pathogènes protozoaires

Giardia enterica , Entamoeba histolytica , et Cryptosporidium spp ont été détectés en utilisant des immunodosages disponibles commercialement auprès de TechLab, Inc et selon les protocoles du fabricant Des études ont démontré d’excellentes performances de ces tests, supérieures à la détection microscopique

Méthodes de contrôle de la qualité

Formation initiale

Une réunion d’investigateurs s’est tenue au début de l’étude au Centre pour le Développement des Vaccins CVD à Baltimore, pour revoir les procédures à utiliser. Tous les chefs de laboratoire des sites de terrain et quelques techniciens ont assisté à la réunion. examiné l’exécution de chaque procédure opératoire normalisée lors des visites sur place et fourni un recyclage si nécessaire

Procédures d’utilisation normalisées

Afin de rationaliser les processus sur chaque site, des SOP ont été générées pour s’assurer que toutes les procédures étaient exécutées de manière cohérente sur chaque site. Les SOP définissaient clairement le but, les matériaux et l’équipement requis, les directives de sécurité, les responsabilités, les procédures et la documentation. en introduisant des formulaires contrôlés pour chaque SOP, une «liste de contrôle de qualité» a été créée pour s’assurer que chaque étape de la SOP a été réalisée conformément aux instructions et que les matériaux utilisés étaient tels que stipulés dans les SOP et avant leur date d’expiration. révisé par le superviseur du laboratoire ou son délégué pour assurer le respect des SOP et que les livrables de qualité ont été générés. Les formulaires incluaient également, pour certains tests, des valeurs négatives, positives et des valeurs seuils non valides ou des tests non valides. , ont été répétées Le taux de remaniement des échantillons a été suivi comme une mesure de qualité

Assurance qualité

Des incidents de qualité et des dérogations aux SOP ont été rapportés et documentés sur des formulaires désignés et examinés par le superviseur sur place et par le personnel de contrôle qualité au cours des visites régulières sur place. Des mesures correctives et préventives ont été exécutées sur place, par le superviseur du laboratoire. Tous les formulaires ont été examinés par le personnel de la Division des contrôles et de la vérification au cours des visites de routine. Tous les formulaires de rapport de cas ont également été examinés par le centre de coordination des données. Les données manquantes et / ou les formulaires manquants ont été communiqués aux sites. D’autres informations, telles que plages de temps, ont également été calculées par le DCCBiannual test de compétence a été menée sur chaque site Les sites devaient marquer% sur l’identification des échantillons «inconnus» envoyés de Baltimore Tous les sites ont atteint ce score Tous les résultats incorrects ont été étudiés et toute erreur corrigée et reconduite fournie si nécessaire sur place par les responsables du laboratoire

Études post-hoc et études de validation

L’étude GEMS a généré une corne d’abondance de souches bactériennes, d’acides nucléiques fécaux et de selles congelées qui vont donner des informations inestimables sur les agents associés à la diarrhée chez les nourrissons et les jeunes enfants dans les pays en développement et leur diversité génomique et sérologique. Les isolats de Shigella dysenteriae ont été testés pour détecter S dysenteriae le bacille de Shiga, tous les Shigella sonnei ont été confirmés sérologiquement, et tous les isolats de Shigella flexneri ont été typés et sous-typés. Ces analyses établiront un profil antigénique. La disponibilité des échantillons cliniques GEMS offre également la possibilité de développer et de valider les méthodes de diagnostic. Par exemple, une comparaison rigoureuse du test RT-PCR multiplex avec la PCR en temps réel pour détection de norovir nous avons été achevés et seront décrits ailleurs En outre, l’archive d’échantillons fournit la plate-forme pour le développement de nouvelles technologies de diagnostic à haut débit et hautement multiplexées, en comparant leurs performances avec des méthodologies de référence.

DISCUSSION

L’étude GEMS a utilisé un portefeuille de tests diagnostiques qui allient praticité et économie, ainsi qu’une bonne sensibilité et spécificité. Un certain nombre de questions importantes méritent d’être approfondies. Nous avons décidé d’utiliser des méthodes bactériologiques conventionnelles pour isoler des pathogènes bactériens présumés, suivis de caractérisations moléculaires et / ou phénotypiques La dérivation de stocks bactériens purs a permis non seulement la caractérisation en aval des marqueurs génétiques et de surface pertinents pour l’épidémiologie et le développement de vaccins, mais aussi de revoir les performances diagnostiques des tests sélectionnés sur des collections de souches archivées. Les colonies d’Escherichia coli ont été isolées , archivé et testé pour la présence de gènes liés à la virulence qui définissent les pathotypes diarrhéiques; Comme indiqué, la validation des ensembles d’amorces EPEC et ETEC a été réalisée sur les archives E coli en utilisant une analyse PCR à haut débit pour l’EAEC, qui n’était pas associé à la diarrhée dans son ensemble, la disponibilité des cultures bactériennes archivées a permis une caractérisation génomique extensive des isolats, identifiant ainsi des génotypes potentiellement pathogènes La détection des amplicons PCR à base de gel d’agarose a été préférée dans l’ensemble de diagnostics GEMS pour les raisons suivantes Au moment du développement du protocole GEMS était peu expert en PCR en temps réel sur aucun des sites du réseau GEMS, et la complexité supplémentaire du temps réel dépassait ce que les programmes de formation pouvaient accomplir de manière réaliste. Les avantages supplémentaires de la méthode à base de gel comprennent des coûts nettement inférieurs. des images gel qui pourraient être partagées entre les sites pour la validation et le contrôle qualité Nous avons décidé d’utiliser des immunodosages pour la détection de pathogènes protozoaires pour plusieurs des mêmes raisons. La détection microscopique directe des pathogènes protozoaires nécessite une expertise importante et ne se prête pas facilement à la validation en aval. Immunoessais, également utilisés pour la détection de certains viraux, suivis d’une méthode simple, hautement standardisée et centralisée qui a été facilement déployée sur les sites d’étude Un autre avantage des méthodes immuno-enzymatiques était la disponibilité du support produit par les fabricants de kits. Les chercheurs du GEMS ont appliqué plusieurs critères pour sélectionner les agents Ces critères incluaient la citation publiée en tant qu’agent significatif de la diarrhée infantile dans de multiples sites dans le monde en développement, et la méthodologie de détection pratique Toxigenic Bacteroides fragilis, par exemple, aurait pu être incluse dans le portefeuille mais aurait exigé la bactériologie anaérobie ou l’utilisation de tests t La disponibilité des archives d’échantillons GEMS permet la détection a posteriori d’agents supplémentaires en utilisant des technologies moléculaires et autres, et ces efforts sont en cours. Toutes les amorces utilisées dans les réactions PCR ont été sélectionnées à partir d’études publiées, conférant ainsi aux deux validation validée par un laboratoire indépendant et un examen par les pairs, et validées dans les laboratoires des chercheurs du GEMS à Baltimore. La validation post hoc a néanmoins été réalisée à l’aide d’études emboîtées sur des réactions PCR individuelles et / ou l’utilisation d’ensembles d’amorces alternatifs. une avancée décisive dans notre compréhension du fardeau et de l’étiologie de la diarrhée chez les nourrissons et les jeunes enfants dans les pays en voie de développement Les données sur l’étiologie du GEMS et les collections de spécimens constitueront de nouvelles avancées dans le futur

Remarques

Soutien financier Ce travail a été soutenu par le projet de loi & amp; Numéro de subvention de la Fondation Melinda Gates Supplément de parrainage Cet article a été publié dans le cadre du supplément intitulé «Le GEMS Global Enteric Multicenter Study», parrainé par le projet de loi & amp; Melinda Gates Foundation Conflits d’intérêts potentiels Tous les auteurs: Aucun conflit signalé Tous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits d’intérêts potentiels Conflits que les éditeurs considèrent pertinents pour le contenu du manuscrit ont été divulgués